CDS

Accession Number TCMCG066C28905
gbkey CDS
Protein Id XP_034603957.1
Location 31328454..31328921
Gene LOC117864076
GeneID 117864076
Organism Setaria viridis

Protein

Length 155aa
Molecule type protein
Topology linear
Data_file_division PLN
dblink BioProject:PRJNA633601
db_source XM_034748066.1
Definition ubiquitin-40S ribosomal protein S27a-2 [Setaria viridis]

EGGNOG-MAPPER Annotation

COG_category J
Description Ubiquitin exists either covalently attached to another protein, or free (unanchored). When covalently bound, it is conjugated to target proteins via an isopeptide bond either as a monomer (monoubiquitin), a polymer linked via different Lys residues of the ubiquitin (polyubiquitin chains) or a linear polymer linked via the initiator Met of the ubiquitin (linear polyubiquitin chains). Polyubiquitin chains, when attached to a target protein, have different functions depending on the Lys residue of the ubiquitin that is linked Lys-48-linked is involved in protein degradation via the proteasome
KEGG_TC -
KEGG_Module M00177        [VIEW IN KEGG]
M00179        [VIEW IN KEGG]
KEGG_Reaction -
KEGG_rclass -
BRITE br01610        [VIEW IN KEGG]
ko00000        [VIEW IN KEGG]
ko00001        [VIEW IN KEGG]
ko00002        [VIEW IN KEGG]
ko03011        [VIEW IN KEGG]
ko04147        [VIEW IN KEGG]
KEGG_ko ko:K02977        [VIEW IN KEGG]
EC -
KEGG_Pathway ko03010        [VIEW IN KEGG]
map03010        [VIEW IN KEGG]
GOs GO:0003674        [VIEW IN EMBL-EBI]
GO:0003676        [VIEW IN EMBL-EBI]
GO:0003723        [VIEW IN EMBL-EBI]
GO:0003729        [VIEW IN EMBL-EBI]
GO:0003735        [VIEW IN EMBL-EBI]
GO:0005198        [VIEW IN EMBL-EBI]
GO:0005488        [VIEW IN EMBL-EBI]
GO:0005575        [VIEW IN EMBL-EBI]
GO:0005622        [VIEW IN EMBL-EBI]
GO:0005623        [VIEW IN EMBL-EBI]
GO:0005737        [VIEW IN EMBL-EBI]
GO:0005794        [VIEW IN EMBL-EBI]
GO:0005829        [VIEW IN EMBL-EBI]
GO:0005840        [VIEW IN EMBL-EBI]
GO:0005886        [VIEW IN EMBL-EBI]
GO:0005911        [VIEW IN EMBL-EBI]
GO:0006508        [VIEW IN EMBL-EBI]
GO:0006511        [VIEW IN EMBL-EBI]
GO:0006807        [VIEW IN EMBL-EBI]
GO:0008150        [VIEW IN EMBL-EBI]
GO:0008152        [VIEW IN EMBL-EBI]
GO:0009056        [VIEW IN EMBL-EBI]
GO:0009057        [VIEW IN EMBL-EBI]
GO:0009506        [VIEW IN EMBL-EBI]
GO:0009987        [VIEW IN EMBL-EBI]
GO:0012505        [VIEW IN EMBL-EBI]
GO:0015935        [VIEW IN EMBL-EBI]
GO:0016020        [VIEW IN EMBL-EBI]
GO:0019538        [VIEW IN EMBL-EBI]
GO:0019941        [VIEW IN EMBL-EBI]
GO:0022626        [VIEW IN EMBL-EBI]
GO:0022627        [VIEW IN EMBL-EBI]
GO:0030054        [VIEW IN EMBL-EBI]
GO:0030163        [VIEW IN EMBL-EBI]
GO:0032991        [VIEW IN EMBL-EBI]
GO:0043170        [VIEW IN EMBL-EBI]
GO:0043226        [VIEW IN EMBL-EBI]
GO:0043227        [VIEW IN EMBL-EBI]
GO:0043228        [VIEW IN EMBL-EBI]
GO:0043229        [VIEW IN EMBL-EBI]
GO:0043231        [VIEW IN EMBL-EBI]
GO:0043232        [VIEW IN EMBL-EBI]
GO:0043632        [VIEW IN EMBL-EBI]
GO:0044237        [VIEW IN EMBL-EBI]
GO:0044238        [VIEW IN EMBL-EBI]
GO:0044248        [VIEW IN EMBL-EBI]
GO:0044257        [VIEW IN EMBL-EBI]
GO:0044260        [VIEW IN EMBL-EBI]
GO:0044265        [VIEW IN EMBL-EBI]
GO:0044267        [VIEW IN EMBL-EBI]
GO:0044391        [VIEW IN EMBL-EBI]
GO:0044422        [VIEW IN EMBL-EBI]
GO:0044424        [VIEW IN EMBL-EBI]
GO:0044444        [VIEW IN EMBL-EBI]
GO:0044445        [VIEW IN EMBL-EBI]
GO:0044446        [VIEW IN EMBL-EBI]
GO:0044464        [VIEW IN EMBL-EBI]
GO:0051603        [VIEW IN EMBL-EBI]
GO:0055044        [VIEW IN EMBL-EBI]
GO:0071704        [VIEW IN EMBL-EBI]
GO:0071944        [VIEW IN EMBL-EBI]
GO:0097159        [VIEW IN EMBL-EBI]
GO:1901363        [VIEW IN EMBL-EBI]
GO:1901564        [VIEW IN EMBL-EBI]
GO:1901565        [VIEW IN EMBL-EBI]
GO:1901575        [VIEW IN EMBL-EBI]
GO:1990904        [VIEW IN EMBL-EBI]

Sequence

CDS:  
ATGCAGATCTTCGTGAAGACCCTGACGGGGAAGACCATCACGTTGGAGGTGGAGTCCTCGGACACCATCGACAACGTGAAGGCCAAGATCCAGGACAAGGAGGGCATCCCGCCGGACCAGCAGCGGCTCATCTTCGCCGGCAAGCAGCTCGAGGACGGCCGCACGCTCGCCGACTACAACATCCAGAAGGAGTCCACGCTCCACCTGGTGCTCCGCCTCCGCGGTGGGGCCAAGAAGCGCAAGAAGAAGACGTACACCAAGCCCAAGAAGATCAAGCACAAGCACAAGAAGGTGAAGCTCGCCGTGCTGCAGTTTTACAAGGTGGACGACGCCACCGGCAAGGTCACCCGCCTCCGCAAGGAGTGCCCCAACGCCGACTGCGGCGCGGGCACCTTCATGGCCAACCACTTCGACCGCCACTACTGCGGCAAGTGCGGCCTCACCTACGTCTACAACCAGAAGGCGTAA
Protein:  
MQIFVKTLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGGAKKRKKKTYTKPKKIKHKHKKVKLAVLQFYKVDDATGKVTRLRKECPNADCGAGTFMANHFDRHYCGKCGLTYVYNQKA